utbk sbmptn saintek 2022 – tka (biologi)

Welcome to your utbk sbmptn saintek 2022 - tka (biologi)

Pernyataan yang tepat mengenai hewan
pada gambar di bawah adalah …

Pada perkembangan tumbuhan, setelah ovum dibuahi oleh inti sperma, zigot yang terbentuk akan berkembang menjadi dua sel seperti gambar berikut.

Dari bagian embrio berikut
l. Hipokotil
ll. Kotiledon
Ill. Radikula
IV. Epikotil
Bagian yang berkembang dari sel terminal adalah …

Pernyataan yang tepat mengenai kehadiran kloroplas dan mitokondria dalam sel tumbuhan adalah ...

Pernyataan berikut yang benar tentang nikotinamid adenine dinukleotida (NAD^+) adalah ...

Terdapat bermacam-macam jenis buah pada tumbuhan berbunga. Di antara contoh buah berikut ini yang tidak mengandung bagian perhiasan bunga adalah ...

Pada suatu populasi yang berjumlah 5.000 jiwa, dilakukan pengukuran terhadap panjang jari telunjuk dan jari tengahnya. Berdasarkan hasil
pengukuran, diperoleh data sebagai berikut.
(1) Laki-laki yang memiliki jari telunjuk yang lebih panjang daripada jari tengah sebesar 1.000 jiwa.
(2) Laki-laki yang memiliki jari telunjuk yang lebih pendek daripada jari tengah sebesar 500 jiwa.
(3) Perempuan yang memiliki jari telunjuk yang lebih panjang daripada jari tengah sebesar 2.000 jiwa.
(4) Perempuan yang memiliki jari telunjuk yang lebih pendek daripada jari tengah sebesar 1.500 jiwa.

Hitunglah frekuensi alel T dan t pada populasi perempuan !

Diagram berikut ini menunjukan konsentrasi antibodi di dalam tubuh bayi sebelum dan setelah dilahirkan.

Diagram Il menunjukan konsentrasi antibodi jenis …

Archaebacteria dan Eubacteria memiliki beberapa kesamaan karakteristik. Di bawah Ini yang merupakan persamaan karakteristik yang dimiliki oleh Archaebacteria dan Eubacteria adalah …

Pernyataan mana di bawah ini yang benar mengenai virion adalah …

Mana di antara leukosit di bawah ini yang akan mengalami peningkatan jumlah reaksi dari infeksi Iokal oleh alergi maupun parasit?

Pernyataan yang tepat tentang tumbuhan tersebut adalah …

Pertanyaan nomor 12 dan 13 mengacu pada keterangan berikut ini.

Urutan nukleotida dari DNA yang mengandung gen yang mengkode protein Met-Tyr-Arg-Leu-Ile
ditunjukkan di bawah ini:
5' - CCCCTATGCCCGGATAATCATATTAGCCTGTACATGGC - 3'
3' -GGGGATACGGGCCTATTAGTATAATCGGACATGTACCG -5'

Tabel Kode Genetik:
Tuliskan urutan mRNA yang mengkode protein tersebut!

Mutasi nukleotida menyebabkan peptide Met Tyr Ser disintesis. Jenis mutasi titik apakah yang dialami urutan nukleotida tersebut?

Populasi rumput pada grafik meningkat dengan pesat karena …

 

Mana yang termasuk peran dari teknologi kultur In Vitro?

Bagian dari mata berikut ini yang berkembang dari bumbung neural (neural tube) adalah …

Dua tanaman, X dan Y merupakan tanaman pangan yang potensial. Tanaman X dapat menjaga Iaju fotosintesisnya pada saat konsentrasi oksigen meningkat dari tingkat yang paling rendah 10% hingga tingkat paling tinggi 50%, sedangkan laju fotosintesis tumbuhan Y menurun drastis pada kondisi tersebut. Simpulan yang dapat diambil dari pernyataan tersebut adalah …

Mana dari berikut ini yang paling tepat menjelaskan mengapa oogenesis pada manusia menghasilkan hanya satu ovum hidup dan tiga badan polar daripada empat ovum hidup?

 

Pohon silsilah berikut menunjukkan pewarisan penyakit hemofilia pada suatu keluarga. penyakit ini disebabkan oleh suatu alel resesif pada kromosom seks. Individu penderita ditunjukkan oleh kotak/lingkaran berwarna hitam.

Jika gen yang terlibat dalam hemofilia disebut gen N, genotipe dari individu pada nomor 1 adalah …

Seorang siswa menyimpan wortel di dalam Iemari pendingin. Setelah satu bulan ternyata pada permukaan wortel tersebut ditemukan adanya struktur serupa serat berwarna putih. Struktur tersebut kemungkinan besar adalah …

Febri berjalan-jalan di kebun dan menemukan tanaman dengan ciri-ciri: pertulangan daun menjari, memiliki umbi akar, dan saat dipatahkan batangnya mengeluarkan getah berwarna putih. Dari ciri tersebut tanaman yang ditemukan Febri termasuk dalam famili ...

Ciri-ciri danau eutrofik sebagai berikut, kecuali ...

Berikut yang bukan termasuk unsur makro pada tumbuhan adalah adalah …

Berikut ini macam mutasi yang terjadi pada gen, kecuali …

Rosa pergi ke taman kota. Di taman terdapat banyak bunga yang sedang mekar. Di taman Rosa melihat seekor hewan yang memiliki ciri dapat terbang, memiliki dua pasang sayap, dan memiliki mulut yang bisa memanjang dan menggulung. Dilihat dari cirinya hewan tersebut termasuk ordo …

Tinggalkan Balasan

Alamat email Anda tidak akan dipublikasikan. Ruas yang wajib ditandai *

Ads Blocker Image Powered by Code Help Pro

Ads Blocker Detected!!!

Maaf, adblockernya dinonaktifkan dulu ya. Agar website ini bisa terus diakses secara gratis.

Terimakasih !!!

Powered By
Best Wordpress Adblock Detecting Plugin | CHP Adblock
error: Content is protected !!
Scroll to Top